3 days
35
7+
Coach
The secret journey of Tonkin is designed for travelers who want to touch, taste and feel the souls of Northern Vietnam through their unique highlights and experiences. More than simple whirlwind tours, the secret journey of Tonkin of Tonkin marry iconic destinations and must-see spots with the hidden corners and below-the-skin experiences to discover some of the famous and unique places around the Halong region.
Comprised of a dozen islands in the Discovery Passage between Vancouver Island and the mainland in British Columbia, we will take you kayaking throughout this sparsely inhabited remote group of islands on this kayaking tour.
Paddling around the islands provides the ideal way to get close to nature and be completely enveloped in the beauty of towering trees, remote beaches, and mountains. Discover the wildlife that inhabit this region and the secrets of British Columbia’s rich and plentiful inter-tidal life while exploring magical waterways.
Around 09:00 – 09:30 AM, the pick-up La Pinta Limousine will take you from Hanoi to Hai Phong on the expressway.
You will arrive at Got pier in which the nice crew is waiting to welcome you with drinks, and then a cruise safety introduction. Enjoy lunch while feasting eyes on the scenic canals and islets of Da Chong (Stacking Stones), Con Vit (Duck Islet), and Gia Luan village (Cat Ba). You will spend the afternoon to explore Trung Trang Valley and Trung Trang Cave in the middle of Cat Ba Island. There will be also time to visit Tra Bau for swimming and kayaking.
Later, relax on this 5-star floating hotel; also, join the cooking show if interested.
The relaxing morning with fresh air, majestic sunrise, and the nice view of local fishing life will be followed by an explorative trip on the bamboo boat to Bright and Dark Cave (Hang Sang Toi).
You have more time to explore Viet Hai fishing village, Da Chong Islet, Cat Ba National Park – Trung Trang Cave, Cua Van area, Ba Trai Dao Beach, Tra Bau area, Van Boi Beach, Ba Ham Lake, and Bright & Dark Cave. Take it easy to directly work with the tour agent on the detail
Get back to the cruise for farewell brunch, pack your stuff for the voyage back to the harbor.
In the meantime, enjoy photo hunting as the cruise peacefully sails across many islands and islets of Lan Ha Bay and Halong Bay
8gv2lp
Their worldwide pharmacists’ consultations are invaluable.
lisinopril bula
They maintain a high standard of hygiene and cleanliness.
Their international drug database is unparalleled.
buying cipro pill
They are always proactive about refills and reminders.
A trusted partner for patients worldwide.
gabapentin24h.top
They set the tone for international pharmaceutical excellence.
mk11bj
Their international patient care is impeccable.
cost generic cytotec prices
Impressed with their wide range of international medications.
They provide peace of mind with their secure international deliveries.
can you get cheap lisinopril without insurance
Their medication therapy management is top-notch.
5w4c3y
legit canadian pharmacy online
https://expresscanadapharm.com/# Express Canada Pharm
buy prescription drugs from canada cheap
ks22ug
v3j4tu
xi4d04
jasvcw
buy augmentin baikal pharmacy Zhao Ling actually thought about taking out all the energy in the astrolabe as resistance, and wanting to die together
vbp8cw
Early counselling and referral of these patients to fertility specialists are fundamental factors in order to maximise their chances of pregnancy where to get cytotec pills
Women are like tea bags, we don t know how strong we are until we were thrown into hot water priligy tablet The resulted cDNA products were next amplified by PCR with primer sets listed as follows SAP forward 5 CGGGATCCAGGCCATGGACGCAGTG 3; SAP reverse, 5 CGGGATCCTCATGGGGCTTTCAGGCAGAC 3; glyceraldehyde 3 phosphate dehydrogenase GAPDH forward, 5 GAAGGTGAAGGTCGGAGTCAA 3; GAPDH reverse, 5 GCAGAGGGGGCAGAGATGAT 3
iz8v7y
8has0g
mfeoyr
I enjoyed the tour and would recommend it to my friends.
Here was so much good about this trip – our guide
Start Date | End Date | Adult Price | Children Price | Baby Price | Special Discount |
---|---|---|---|---|---|
18-08-2022 | 24-08-2022 | $200.00 | $190.00 | $1.00 | View Discount |
Leave feedback about this