Miniatur Wunderland & Historic Port of Hamburg

Duration

3 days

Max People

35

Min Age

7+

Pickup

Coach

Overview

The secret journey of Tonkin is designed for travelers who want to touch, taste and feel the souls of Northern Vietnam through their unique highlights and experiences. More than simple whirlwind tours, the secret journey of Tonkin of Tonkin marry iconic destinations and must-see spots with the hidden corners and below-the-skin experiences to discover some of the famous and unique places around the Halong region.

Comprised of a dozen islands in the Discovery Passage between Vancouver Island and the mainland in British Columbia, we will take you kayaking throughout this sparsely inhabited remote group of islands on this kayaking tour.

Paddling around the islands provides the ideal way to get close to nature and be completely enveloped in the beauty of towering trees, remote beaches, and mountains. Discover the wildlife that inhabit this region and the secrets of British Columbia’s rich and plentiful inter-tidal life while exploring magical waterways.‍

Tour Highlights

  • Be enveloped in the beauty of towering trees, remote beaches, and mountains of the Canadian wilderness
  • Have close encounters with BC’s coastal wildlife; sea lions, seals, pacific white sided dolphins, otters, birds and some of the largest starfish in the world
  • Be on the lookout for Humpback whales that have made a strong resurgence in the Discovery Islands
  • Coastal cuisine designed by a local gourmet chef
  • Quality expedition tents & warm sleeping bags all included in the price of the trip

Included/Excluded

  • Specialized bilingual guide
  • Private Transport
  • Box lunch water, banana apple and chocolate
  • Departure Taxes
  • Entry Fees
  • 5 Star Accommodation

Tour Plan

Day 01 Departure

Around 09:00 – 09:30 AM, the pick-up La Pinta Limousine will take you from Hanoi to Hai Phong on the expressway.

You will arrive at Got pier in which the nice crew is waiting to welcome you with drinks, and then a cruise safety introduction. Enjoy lunch while feasting eyes on the scenic canals and islets of Da Chong (Stacking Stones), Con Vit (Duck Islet), and Gia Luan village (Cat Ba). You will spend the afternoon to explore Trung Trang Valley and Trung Trang Cave in the middle of Cat Ba Island. There will be also time to visit Tra Bau for swimming and kayaking.

Later, relax on this 5-star floating hotel; also, join the cooking show if interested.

Day 02 The South Coast

The relaxing morning with fresh air, majestic sunrise, and the nice view of local fishing life will be followed by an explorative trip on the bamboo boat to Bright and Dark Cave (Hang Sang Toi).

You have more time to explore Viet Hai fishing village, Da Chong Islet, Cat Ba National Park – Trung Trang Cave, Cua Van area, Ba Trai Dao Beach, Tra Bau area, Van Boi Beach, Ba Ham Lake, and Bright & Dark Cave. Take it easy to directly work with the tour agent on the detail

Day 03 Optional Activities

Get back to the cruise for farewell brunch, pack your stuff for the voyage back to the harbor.

In the meantime, enjoy photo hunting as the cruise peacefully sails across many islands and islets of Lan Ha Bay and Halong Bay

Tour Map

8 reviews for Miniatur Wunderland & Historic Port of Hamburg

5 Star

100 %
2 review(s)

4 Star

0 %
0 review(s)

3 Star

0 %
0 review(s)

2 Star

0 %
0 review(s)

1 Star

0 %
0 review(s)

Reviewed by 07 customer(s)

  • Avatar

    📦 Ticket: + 1,820000 BTC. Verify > https://telegra.ph/Message--2868-12-25?hs=c4149924b7f176113cb8a0f7666219e2& 📦

    vbp8cw

    January 14, 2025
  • Avatar

    cost generic cytotec without rx

    Early counselling and referral of these patients to fertility specialists are fundamental factors in order to maximise their chances of pregnancy where to get cytotec pills

    November 30, 2024
  • Avatar

    Baislilla

    Women are like tea bags, we don t know how strong we are until we were thrown into hot water priligy tablet The resulted cDNA products were next amplified by PCR with primer sets listed as follows SAP forward 5 CGGGATCCAGGCCATGGACGCAGTG 3; SAP reverse, 5 CGGGATCCTCATGGGGCTTTCAGGCAGAC 3; glyceraldehyde 3 phosphate dehydrogenase GAPDH forward, 5 GAAGGTGAAGGTCGGAGTCAA 3; GAPDH reverse, 5 GCAGAGGGGGCAGAGATGAT 3

    November 16, 2024
  • Avatar

    📅 Notification- TRANSACTION 1,82536 BTC. Withdraw >> https://telegra.ph/Go-to-your-personal-cabinet-08-25?hs=c4149924b7f176113cb8a0f7666219e2& 📅

    iz8v7y

    November 7, 2024
  • Avatar

    💿 You got a transfer from unknown user. Gо tо withdrаwаl >>> https://telegra.ph/Go-to-your-personal-cabinet-08-25?hs=c4149924b7f176113cb8a0f7666219e2& 💿

    8has0g

    October 9, 2024
  • Avatar

    📕 You have received a message(-s) № 338. Read - https://telegra.ph/Go-to-your-personal-cabinet-08-25?hs=c4149924b7f176113cb8a0f7666219e2& 📕

    mfeoyr

    October 8, 2024
  • Avatar

    John

    Wow, Great Tour !!!

    I enjoyed the tour and would recommend it to my friends.

    August 9, 2022
  • Avatar

    Alani

    Miniatur Wunderland & Historic Port of Hamburg

    Here was so much good about this trip – our guide

    August 9, 2022

Leave feedback about this

Your email address will not be published.

From
$222.00
Booking Form
Enquiry Form
1
$222.00
$200.00
$100.00 /per person
$60.00 /per person
$1.00 /per person
Deposit Option 50% Per item
Available:
Total:
Insurance included:
1
$222.00
$200.00
$100.00 /per person
$60.00 /per person
$1.00 /per person
Start Date End Date Adult Price Children Price Baby Price Special Discount
18-08-2022 24-08-2022 $200.00 $190.00 $1.00 View Discount